circad | circRNAs associated with diseases

hsa_circRNA_100338/circSNX27
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Liver Cancer	ICD-10	Malignant neoplasm of Liver, unspecified (C22.9)
DBLink	Link to database	PMID	28710406
Experimental Method
Sample Type	Tissues	Comparison	snap-frozen Hepatocellular Carcinoma tissue and matched para-carcinoma tissue
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AAAAGCAAGCAGTGCCCATA Reverse GCTCGAATCAGGTCCACCA	Statistics	Fold Change : Upregulated,11.5 pvalue : p=0.037423
Citation
Huang, XY, Huang, ZL, Xu, YH, Zheng, Q, Chen, Z, Song, W, Zhou, J, Tang, ZY, Huang, XY (2017). Comprehensive circular RNA profiling reveals the regulatory role of the circRNA-100338/miR-141-3p pathway in hepatitis B-related hepatocellular carcinoma. Sci Rep, 7, 1:5428.